INTERVIEW WITH MARTIN NG
interview by Andy Beta
1. What do you think of the Avalanches?
From the stuff that I've heard on the radio over here, the Avalanches are a cheesy, slightly left-of-center sample-based pop band. For me, really literal sample based music rarely works and rarely escapes sounding kitsch. Like everything, I guess, there are exceptions which support the rule, such as the use of a "Trans Europe Express" sample in "Planet Rock" or the Liquid Liquid bassline sampled in Grandmaster Flash's "White Lines". But I do think that the DJ/turntablist in the Avalanches, Dexter Fabay, is a pretty killer hip-hop DJ.
2. I knew they were blowing up here, but not on the radio. Any sort of breakthrough like that is somewhat intriguing to me though. The only music that is both popular and challenging is along the lines of what you mention, in that these appropriations are most likely heard in popular rap/R&B formats.
One of the problems with mass media in consumerist societies is that radio and television no longer represent a popular mainstream but a corporate mainstream. One no longer gets airplay on the basis of popularity per se but on how your music can potentially augment the sales of Coke or Nike products. Singles receiving commercial airplay are in essence co-opted music for adverts. For instance, whilst a band like Radiohead may move millions of units - it's difficult to use their angst-infused musings in the context of pushing fast food. In Australia, we have been fortunate to have reasonably strong public and community-based broadcasting sectors. Some of these stations have managed to capture a sizeable share of the national listenership and hence have placed pressure on commercial networks to slightly broaden their narrow broadcast parameters.
3. Any current DJs or producers that you like?
Unfortunately, for me, popular DJing seems to be heading towards that wall at the moment. Stretching the term popular leftwards - Thomas Brinkman, I think, has been one of the more innovative and intelligent minimal beat guys and turntablists for a few years now. He remixed Ritchie Hawtin's Concept releases by playing the records on a slower speed using a specially made heavy turntable with 2 tone arms (one for left and one right channel - one follows the other producing a seductive panning effect) - creating a really sensual and sonically interesting take on minimal techno. That release probably surpasses any of Hawtin's own work. Also, I find Brinkman's take on turntablism, like on Klick, with its emphasis on minimal self cut inter-locked grooves and vinyl clicks kind of interesting.
As for hip hop, I liked this ambitious 12" release by a guy called "Radar". Every sound on the track was realised by skratching and it had this awesome wah wah vinyl riff. The release also came with its own booklet proposing a new notation system for turntablists. I also like High Priest of Anti Pop Consortium's stuff. He put out an excellent 12" last year which featured hip hop drum programming that sounded like it had been done by some strange inter-marriage between Ikue Mori + a dot matrix printer. The tracks he produced on the new Anti Pop CD are the more interesting ones. I find some of Timbaland's production for Missy E and Aaliyah to be pretty killer. In fact, some of the European clicks'n'cuts guys have taken to substituting the percussion sounds on Timbaland tracks with digital bleeps as a way of making tracks.
4, What else can you tell me about the DJ culture over there?
DJ culture in Australia is largely pretty lame and terribly conservative - essentially an endless platter of bpm-matched cliches. Unlike the states, there has never been a scene or movement of interesting DJs. However, there have been some exceptional figures amidst this ocean of mediocrity. I have mentioned Dexter Fabay, who is a virtuosic hip hop DJ who has done well in DMC comps. One other example would be Lucas Abela (founder of Dual Plover records) - originally a turntablist whose work was heavily based on constructing an array of mutant turntable systems with features such as: multiple record needles (often worn on a Freddy Kruger-like glove) and monstrous motor systems. Otomo Yoshihide has previously credited Lucas as being an influence on his own turntablist practice.
5. Is Lucas still actively doing stuff?
Lucas is uncompromisingly out-there! He isn't as active as he used to be though. These days his "turntable" set-up has been reduced to a sharp hand-held metal prod connected to a whole lot of effects pedals which are worn as a belt. Live, he chews on the prod like he's a rabid dog and flings himself about while generating a whirlwind of noize. His stuff always borders on acts of self-harm. Lucas' madness leaves an indelible image on the mind. I've run into guys like Bob Ostertag or Pita who've only seen him once but who remember it b'cos they've been kinda freaked out by the lunacy and violence.
Over the years Lucas and I have done a few things together. I've never been engaged into the whole noise thing like he has been but we share, to an extent, a love of sonic entropy.
6. Do you work as a DJ straight up?
I began DJing in the late 80s in a variety of clubs. Soon after, I found the narrow constraints of Sydney club DJing completely incompatible with my own ideas about DJing. In subsequent years, I have run a number of experimental radio shows on community radio (somewhat akin to college radio in the states) where I have been able to intermittently test new DJ ideas. Occasionally I surface for DJ sets at small and large events, but Sydney is really a parched desert when it comes to venues for non-commercial music.
7. Do you ever just "play out" at a party?
I would love to be able to do this more often but unfortunately, Sydney is a town of middle-of-the-road clubs. Using, a combination of turntables and a virtual "turntable" interface on powerbook, I've been trying to develop a microcutting style of DJ mixology for this kind of purpose. I'm actually going to be playing for an arts association party this weekend - but this is an infrequent opportunity.
Throughout the 90s, I became increasingly involved in using DJ tools for improvised music. One of my first collaborations with Oren Ambarchi was as part of an ensemble for his version of John Zorn's Cobra game. I guess in the late 80s and early 90s, much of the avant-improvisation community in Sydney was very much enthralled with Zorn. To fit in with that sound, my playing at that time was influenced by the "Lower East Side" style of plundering and jump-cutting musical genres.
8. Is that how you met Oren?
Oren was introduced to me by one of his friends around 8 years ago through a fortuitous accident. One of his friends gatecrashed a party I had where we all ended up jamming and told me I had to meet him b'cos we shared similar musical ideas. A whole host of basement jams and more realised projects have come out of our meeting since that time.
Oren learnt Cobra from Zorn during one of his visits to NYC and decided to stage an Australian version for his first ever "What is Music Festival" (Australia's largest experimental music fest founded by Oren and drummer Robbie Avenaim in 1994). He ended up rounding up an impressive roster of local "name" improvisors, some of whom could have been at least twice our age at the time. As mentioned, he asked me to play turntables. As always, Oren had a really rigorous approach to the project and relentlessly rehearsed the ensemble for about 2-3 months twice a week! - unheard of for an improvisor. The surprising thing for me was how he could get these established guys to show up despite their protestations about the frequency of rehearsals. Anyway, when we finally debuted it - it rocked. It was improvisation which could turn 360 degrees on a dime. Since then Oren has stripped and modified the Cobra concept to make it faster and more ridiculous - he now mainly uses Cobra to control an improvising ensemble which serves as a backing band for an ingenious veteran guitar improvisor called Greg Kingston - the project is called the Greg Kingston Big Band.
9. Did you like what people like David Shea and Whiz Kid were doing in the context of those Zorn pieces at that time?
Zorn's ambitious jump-cut/postmodern works, like The Big Gundown or his game pieces, were some of the best things in improvised music during the 80s, I think. I remember listening to stuff like Locus Solus, which featured Whiz Kid, and being blown away by the razor sharp improv acuity between the players, the almost "pop" energy of the short pieces and by the rapid-fire appropriations of all sorts of genres by all the players - not just the DJs.
However, it's gotten to a point where the cut 'n paste concept in all genres of music is all but exhausted. It was really an intersection of musical influences and science that finally got me away from the "quotation" game. As much as I was affected by the lower eastside genre-hopping thing, I have always been more influenced by musicians who work in an abstract domain such as Cecil Taylor, Conlon Nancarrow and the more adventurous Invisibl Skratch Piklz' stuff. Nancarrow's use of player-pianos to execute these brilliant hyper-articulations are a precursor to computer music and his trailblazing work remains an enduring influence on me.
As a DJ, you not only end up working with other people's sound but also with the way these sounds are articulated. I've become more and more interested in the way I can construct novel articulations through several generations of re-articulation. One of the things I have been doing is skratching using records of skratching and then recording the output onto a CD and then CD-skratching that and so forth.
10. Is it in this way that you achieved the idea of "atomization"?
One of the ways I guess. Amongst the many things I do, I also rarely turn on the turntable motors, preferring instead an entirely manual approach that provides for more control of small sound fragments, Recently, Hiaz and I have been developing virtual turntable interfaces on laptop to augment my set-up. These interfaces provide for some mad vinyl cutting/manipulation options on top of traditional analogue decks.
So.... for me, a more profound way of solving the DJ's need to transcend one's borrowed material involves a process that begins with the "atomisation" of vinyl.
Since the time of that realisation, I have tried to strongly shift my own DJ practice away from crude "cut and graft" sound horticulture into a realm where the vinyl source material is, to an extent, atomised and no longer recognisable.
Another pervasive influence for me are the ideas inherent in molecular science - the concept that an entire biology can be changed through recombinations occurring on a genetic level. Of late, I've become obsessed with reducing vinyl fragments to their smallest essence and then trying to radically re-constitute from there.
11. I know that "gcttcatt" is a certain strain of DNA that is related to your work. What does that protein strain do?
Like most of my artistic partnerships, most things come together without much verbal deliberation. Actually, it was Hiaz, who is obsessed about stuff like data streams/architectures and data transformations, that came up with the phrase "gcttcatt" as our proposed band name. Of course, knowing that G, A, T, and C are the symbols for the 4 basic molecules which make up the constituent alphabet of the DNA code, I looked at the name and immediately thought - fuck me! - this is a short DNA sequence and an ideal name for our nano-DJ band.
12. Didn't they recently find that a large percentage of DNA coding is gibberish?
You are right. Mass redundancy and repetition, as in "ggattctcattcctcggaagatc etc," is a great part of life. 99% of the human genome sequence codes for nothing. Most of the sequence, as far as we know, is junk.
13. What sort of freedoms do you have now, as a DJ, operating at such a molecular level with the vinyl?
I think the sample dependency of many DJs is a real ball and chain dragging at the feet of the art. I get the feeling that a lot of hip hop DJs put out very few records (e.g. Q-bert & Kid Koala) b'cos they've basically turned over their entire favourite sample collection by the time they're reached the end of their 10-20 minute trick-set, making "original" music creation rather difficult.
14. What did you discover about the sound on such a fragmented and isolated level?
As a turntablist, I sometimes envy the kick-ass sonic plasticity of some of the G3 musicians (e.g. Mego crew) and old-school electronicists (e.g. Bernard Parmegianni). Working within the abstract realm of small sound fragments, I find I can extend the sonic frontiers of the decks a bit further. For me this avenue of DJing remains a work and technique in progress - I'm often surprised by the sonic outcomes and flexibility that is possible. For instance, tracks 4 and 5 of ampErase, which make up single live set from the Rhiz in Vienna last year, are a work-out using Oren's first stacte release as the main piece of vinyl for almost the entirety of the two tracks. Working as I do - the methodology often becomes more important that the source vinyl - a lot of the time (like on the last 3 tracks of the ampErase), I don't even recall what records I used. From a practical point of view, it means that I can go on tour with about a quarter of the number of records an average DJ takes onto the road - which must give my shoulders an extra couple of years in life-expectancy, me thinks!
15. What led to you DJing in the first place?
I've been attracted to the concept of working with records since I was in my mid teens. I'm not sure exactly what tracks sucked me into it, but stuff like Grand Master Flash and the Furious Five's "Adventures with the Wheels of Steel" and Eno and Byrnes's "My Life in the Bush of Ghosts" (for its prescient use of samples) had an influence. Coming from an instrumental background, my gut reaction to DJing was to try to play the turntable as an instrument in its own right and to try to transcend the idea of a DJ just being a music "selector".
16. Is the piano your first instrument?
Yes it is. I guess that's partly why guys like Cecil Taylor, Thelonious Monk, and Conlon Nancarrow are of great interest to me. I also think that maybe my "instrumental" approach to turntablism/DJing stems from coming to the decks from the keyboard background.
17. How long did you study for? I know that all my years of lessons have completely gone down the brain. I can't even remember middle C!
I was kind of forced onto the piano by middle class parents who thought it was the "done thing" at the age of 7. Like 99% of kids, I was a piano drone until mid high school - just hammering away to keep the school and folks at bay. I never reached any great proficiency in the thing and it wasn't until I encountered Monk and Taylor that I became aware of the power of the instrument. I still fuck around with keyboard stuff at home, but only for self-therapy.
In recent years, software has really replaced the keyboards as a composing tool for me. While, as Jim O'Rourke recently noted, the world seems to be aflood with laptop cliches, there still seems to me to be an abundance of uncharted territory for silicon-based music to navigate through.
18. I think some of those piano players, in particular, have a very analytical approach to the instrument, having a method to their work that the creativity flows through, not the other way around. Very idiosyncratic.
Yes, I see what you mean. I am increasingly interested in "novel" approaches, even non-musical ones, because they can facilitate the realisation of new sonic possibilities. In recent years the world of "music and sound" has been invaded by practitioners who don't really have a "music background" or even a real "music interest". As opposed to guys like Nancarrow etc, many of these artists don't have music as the primary artistic endpoint. So we have computer geeks, sculptors, mathematicians, artificial intelligence theorists, visual arts students, etc. all weighing into the scene with their own take on things. Like many, who regard themselves as "true" music nuts, I initially regarded this "invasion" with disdain thinking that guys who didn't intensively listen to or even like music couldn't possibly make a meaningful contribution. However, I no longer think that's true. For example, I have played with and listened to guys for whom music is just an output of a mathematical model or data transfer architecture and have often found the works fascinating. There can be a certain naivety and uniqueness to work that is spawned from non-musical/analytical thinking - these works are often refreshingly unreferential.
Ultimately, of course, no amount of methodological or conceptual innovation can get you anywhere if the music doesn't rock. It just helps to have new ways or imposed limitations to try to overcome idiomatic cliches.
19. Especially in the duo with Oren, I had a hard time distinguishing "a turntable" per se. It was very much turned inside-out, or approached from without the normal turntable vernacular.
The Ambarchi and Ng collaboration was realised after both of us were exposed to a maelstrom of noisy avant improv that was part of the What is Music? Festival (WIM) two years ago. At the time when we decided to collaborate, we had no predetermined plans as to what we actually wanted to record. For me, after WIM, I wanted to remove myself from the free jazz aesthetic of relentless attack and sonic gestural saturation. We both wanted something quite opposite to that. Also, ever since running a multicultural arts radio documentary series 10 years ago, I have been fascinated by the stillness of Central Asian Buddhist musics - this played a role in shaping the ideas behind Reconnaissance.
I think distinguishing whom is doing what in Reconnaissance is irrelevant because we were keen to remove almost all instrumental references. For me, the works were approached as singular harmonic compositions rather than instrumental duos - this also holds true for our follow-up release. We're working on it right now, actually. It's going well-I love our Ambarchi/Ng thing. Hopefully there will be more of a visual aspect involving Tina Frank, aside from the cover art. We're both big fans of her work and we have been trying to organise a live tour of cinematic concerts in collaboration with Tina. She's currently making a short video for one of our pieces which may be released as part of the "Recon" follow-up.
20. I really like that project. It took awhile to sink in, but it's very peaceful. Actually, I think the first thing that struck me about the CD was that you named your studio after my favorite Caetano Veloso record, Araca Azul.
It is also my favourite Veloso record! I have a deep fondness for Brazil and its music. A few years ago, I went there for a month and then found myself so powerfully attracted to the country that I went there again for another 6 weeks in the same year! Sometimes, there seems to be almost limitless breadth and depth in Brazillian music - in particular great pop seems to just seep out of its pores. During the recording, Oren and I were obsessively searching for and ordering Brazillian records over the internet. At every available interval during our sessions together, we were scouring the web for more Brazillian music. So when it came down to naming the studio - I had no hesitation in calling it after one of my faves.
For me, Araca Azul is to pop records what the works of Joyce or Beckett are to English literature - it ambitiously constructs a new sonic lexicon of profound beauty. There is an outrageous sonic inventiveness - all the weird sounds, electroacoustic influences, unfathomable arrangements - that just
magically hangs together somehow.
21. It's weird that he threw off that record in a week's time, and yet never really returned to that level of exploration afterwards. I mean, there is always that sort of avant garde dabbling by popular folks (ie Radiohead), but that record is quite beyond the pale, even for the more freaked out Tropicalia records.
The record had a lot to do with the particular time and place in his life. He had just returned from self-enforced exile in England (actually deported -ed.) and was pretty fucked up and dislocated from mainstream Brazillian culture.
Once an artist becomes integrated/assimilated by wider culture/subculture, there is an immense expectation to conform. You feel it even if you are making "experimental" works. That's why most stuff that passes for "experimental" isn't anything like the sort - there is usually a worrying homogeneity in the scene and, like all scenes, it is a victim to all sorts of fads. That's why I think that once Veloso was back under the spotlight in Brazil, he turned back to churning out his well crafted pop.
22. How do you deal with the pressures of a professional and creative life at present? How does one inform the other? Is playing a release from your work?
Juggling the demands medicine and music and life has been difficult. I don't think I would have continued making music all this time if it wasn't for the fact that I have a need to. I don't see my situation as being particularly different from most non-mainstream artists - we almost always need to support ourselves with another vocation. As my work in both fields has matured a little, they have started to inform and reciprocate each other. I do a fair amount of research in the field of human genetics and genomics and, I guess even at a superficial level there is an intersection of ideas between my music and science.
Briefly, both biology and the electronic arts are in the midst of a profound intellectual and experimental sea change driven by similar ideas. In biology, as in music, much of the transformation has been facilitated by technological advances which have enabled understanding and intervention at "molecular" levels or at levels of the DNA. Analogous to the DJ and his/her records, the molecular biologist deals with the immense power implicit in the splicing, processing and mutation of an inherited code. As I mentioned before, the understanding that interventions at a molecular level can realise fundamentally powerful outcomes informs some of my DJing.
For years, playing was a release from the highly controlled world of my day job and also a reaction against the often shitty environments I had to play in, like noisy and smoky Australian pubs with disinterested audiences and bad sound systems. I think the belligerence people hear in my turntablism is partly a product of these two factors. Hiaz made mention a while ago that the reason why we love playing together is because, live, the gcttcatt kicks - the concepts, ultimately, are somewhat secondary.
23. Does the distance between you two help the music in any way?
I think finding people with whom you can have an intuitive artistic relationship with is pretty rare, in my experience. It has taken me a very long time to find working relationships with which I am happy. At the moment, I feel terribly fortunate to have excellent collaborative relationships with Oren, Jim and Hiaz.
Hiaz and I work in a very intuitive manner. At heart, I think we share some really basic obsessions with sound/music + art. For example, his thing with information and data transformation really fits in well with my "genomic" notion of a DJ. Hiaz isn't a very verbal guy - so we often just work together without much mutual pre-meditation. This, I think, is also pretty much the case with all my collaborations. Sometimes, too much discussion can lead to the work being kinda like a "textbook" illustration of ideas and techniques rather than something that surprises you and transcends its component parts.
The distance has interesting effects on our collab. In the gaps between us meeting, we both seem to independently develop our own new ideas for pushing the duo forward. So when we first get together after a break, it's often a great surprise b'cos each of us throw all these new ideas we've come up with in the intervening period at each other. So the development of the group happens more in bounds and stutters that in any gradual fashion.
24. Any plans for a solo exploration of the turntable?
Often I feel that I have all these records in my head and that if I only had the time… Anyway, there are a number of projects in the works. gcttcatt will release an EP worth of live material for a forthcoming Fals.ch 3"CD release. We are also working on something for an Asphodel comp. We plan to produce a full-scale audiovisual release (probably for DVD format) and are looking around for collaborators (rappers) to possibly do a gcttcatt hip-hop record. Oren and I have virtually finished our follow-up to Reconnaissance. Jim Denley and I have been working on a follow-up to Vergency. This CD will feature a woodwinds "trio" in which Jim, Hiaz and myself all play the woodwinds of Jim Denley.
I have been turning over ideas for a solo work for turntables for sometime now. If and when this becomes realised, I suspect that it will be a departure from my current sound space.
25. Would you ever give up your career as a cardiologist and focus on the music?
No I don't think so, not at the moment. I do also love medicine and science. I do feel strongly that as a doctor and a scientist in an increasingly technologically dependent society, there is a moral imperative for all of us doctors and scientists to be passionately engaged in the humanities/arts. Scientific progress without a humanistic vision may well have catastrophic consequences. In a reciprocal manner, in a universe increasingly "explained" away by scientific dogma - it is incumbent upon artists to engage in the broader scientific dialogue.
26. When I saw Hiaz here, he had this video of a robot dog rolling over and over and over, and I was reminded of this Richard Feynman quote, where he mentions some scientific problems, like: "We don't really know how dogs work." It's funny that we think we are figuring out lots of things, when in fact, we have so far to go. Maybe we're not really going anywhere…
Feynman was right on the money. Implicit in what he says is an understanding that NOT ONLY are most phenomena YET TO BE KNOWN but also that much of our universe IS NOT KNOWABLE through a purely scientific approach. Even if we were to have a precise understanding of canine biology, would we really begin to know how dogs work? I have come now to realise that the science and medicine that I engage in offers me no more "truth" than my turntablism and electronic music.
As you know, we live in an age where the understanding of our tangible universe has taken a far greater pre-eminence over the need for metaphysical understanding. I don't know about you, but I have never gotten used to the fact that the vast majority of our society's "best educated" (i.e. the doctors, lawyers, architects, bankers etc.) in my generation know nothing much about the world around them and want to know nothing much more about music other than Mariah Carey and Ricky Martin. I go to work everyday with a bunch of bright professional people only to be constantly reminded that we're mired in a metaphysical third world.
Whenever I go to an event that still manages to engage in raw artistic vision, like the What is Music Festival or something similar - I look around at the audience and I am reminded that the spirit of metaphysical and cultural inquiry in our age has been taken up, not by our "best and brightest," but by a rag tag bunch of have-nots, high school drop-outs, hippies, squatters and general losers. Perhaps this has always been a role of the displaced?
27. There is always that splitting between the creative and financially successful, I think. I'm just finishing up this book called Guns, Germs, and Steel, about the fate of various human societies. The section on Australia and is very interesting indeed. I never even knew it was such an arid continent.
Yeah - we are having really bad bushfires right now. It's surreal; there are some days you cannot see our Harbour Bridge as the air is thick with particulate ash. These are the worst fires since I've immigrated to Australia. Perhaps the most unsettling aspect of it is that the majority of the many fires have been caused by arsonists. I don't know why it is like this, but I get a sense that the country I live in is becoming increasingly fractured socially.
28. We both have continents where its previous habitants were nearly eradicated. I think if it weren't for those deserts to recede into with the influx of colonists, the Aborigines might have been wiped out completely.
It is interesting to note that James Cook, who settled Australia for Britain, noted in his diaries that, despite their lack of material advancement, the Aborigines seemed to be amongst the most content peoples that he had come across in his travels.
29. That's what the book is also saying. They just didn't need anything more than stone tools or barest of necessities. It would have been pointless in such a desert.
How do you feel about being an immigrant to Australia? Have you ever interacted with the Aborigines at all?
In many ways, I feel fortunate as a Chinese immigrant from Malaysia. Coming from a country where educational, occupational, religious and political opportunities of racial minorities are very strictly curtailed by law, I feel that I wouldn't have had the chances to do what I've done if my family didn't move to Oz.
At the same time, I feel a great dismay about the socio-political environment in Australia at the moment. We have a prime minister and government that is both doggedly anti-intellectual and unapologetically xenophobic. As one wanders around Sydney or Melbourne's institutions, one is left in no doubt that this is very much an Anglo-Saxon-run city. There is clearly a glass ceiling for non-English speaking background folk here, particularly in the traditional establishments.
Unfortunately, I have only interacted with Aborigines as a doctor or as a radio broadcaster. Their plight in this country continues to be tragic.